TranscriptionalRegulation_hrcA_TU_155 – Transcriptional regulation of TU_155 by hrcA

Name
WID TranscriptionalRegulation_hrcA_TU_155
Name Transcriptional regulation of TU_155 by hrcA
 
Regulation
Transcription unit TU_155 View in model
Transcripton factor MG_205_DIMER View in model
Binding site 282824283851 MG_238 MG_239
Chromosome: Mgenitalium_Chr_1, Coordinate: 283324 (nt), Length: 27 (nt), Direction: Forward, Sequence:
1
TTAGCACTCAAAGCTTGTGAGTGCTAA
27
 View in model
Fold‑change activity
0.1751 (dimensionless)
 View in model
 
Comments
Comments HrcA represses the transcription of the heat-shock proteins including chaperones and chaperonins [PUB_0186, PUB_0418, PUB_0419, PUB_0433]. HrcA recognizes the CIRCE motif (TTAGCACTCAAA[GC][TGC][ACGT]TT[TA]GAGTGCTAA). HrcA transcriptional regulatory activity was measured in M. genitalium [PUB_0186] and M. pneumoniae [PUB_0418]. HrcA is repressed by heat, leading to derepression or increased expression of chaperones and chaperonins [PUB_0186, PUB_0418, PUB_0419, PUB_0433]. Binding site has motif CIRCE (TTAGCACTCAAA[GC][TGC][ACGT]TT[TA]GAGTGCTAA). Site responds to the condition: absence of 42C heat.
References

  1. Güell M, van Noort V, Yus E, Chen WH, Leigh-Bell J, Michalodimitrakis K, Yamada T, Arumugam M, Doerks T, Kühner S, Rode M, Suyama M, Schmidt S, Gavin AC, Bork P, Serrano L. Transcriptome complexity in a genome-reduced bacterium. Science 326, 1268-71 (2009). WholeCell: PUB_0418, PubMed: 19965477

  2. Musatovova O, Dhandayuthapani S, Baseman JB. Transcriptional heat shock response in the smallest known self-replicating cell, Mycoplasma genitalium. J Bacteriol 188, 2845-55 (2006). WholeCell: PUB_0186, PubMed: 16585746

  3. Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic Acids Res 36, D93-6 (2008). WholeCell: PUB_0419, PubMed: 17962296, URL: http://dbtbs.hgc.jp/

  4. Zuber U, Schumann W. CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis. J Bacteriol 176, 1359-63 (1994). WholeCell: PUB_0433, PubMed: 8113175
 
Metadata
Created 2012-10-01 15:09:28
Last updated 2012-10-01 15:18:56