MG_0001 – scRNA, signal recognition particle 4.5S RNA, MCS1
Name | ||
---|---|---|
WID | MG_0001 |
![]() |
Name | scRNA, signal recognition particle 4.5S RNA, MCS1 |
![]() |
Symbol | ffs | |
Synonyms | 4.5S RNA, scRNA | |
Cross references | CMR: MG_0001 | |
Classification | ||
Type | sRNA |
![]() |
Structure | ||
Structure |
![]() |
|
Sequence | Chromosome: Mgenitalium_Chr_1, Coordinate: 325924 (nt), Length: 83 (nt), Direction: Reverse, G/C content: 42.2%, Sequence: 1 51 AGAACCATCACATCATTAGAGTCGAATCATGTCAGGCCAGAAATGGAGCA GCATTAAGACTTGTCAGTGAGTGTGATGGTTTT 50 83 |
![]() |
Transcription unit | TU_178 |
![]() |
Empirical formula (pH 7.5) | H892C808N349O578P83 | |
Molecular weight (pH 7.5; Da) | 27310.51 |
![]() |
Functional genomics | ||
Is essential | Yes (Show evidence) |
![]() |
Relative expression | 736.872 (dimensionless) (Show evidence) |
![]() |
Half life | 1200.0 (min) (Show evidence) |
![]() |
Extinction coefficient (260 nm, 25C, pH 7.0) |
830900 | |
pI | 3.84 | |
Function | ||
Complex subunit | signal recognition particle [c]: MG_0001 + MG_048_MONOMER ⇒ MG_0001_048 |
![]() |
Comments | ||
Comments | Half-live ≫ 10 minutes [PUB_0397]. Half-lives of sRNA span great range, 60 min for housekeeping and regulatory genes [PUB_0398]. Expression 25% that of ribosomes [PUB_0401]. | |
References |
|
|
Metadata | ||
Created | 2012-10-01 15:07:09 | |
Last updated | 2012-10-01 15:12:37 |