MG_0001 – scRNA, signal recognition particle 4.5S RNA, MCS1

Name
WID	MG_0001
Name	scRNA, signal recognition particle 4.5S RNA, MCS1
Symbol	ffs
Synonyms	4.5S RNA, scRNA
Cross references	CMR: MG_0001

Classification
Type	sRNA

Structure
Structure
Sequence	Chromosome: Mgenitalium_Chr_1, Coordinate: 325924 (nt), Length: 83 (nt), Direction: Reverse, G/C content: 42.2%, Sequence: 1 51 AGAACCATCACATCATTAGAGTCGAATCATGTCAGGCCAGAAATGGAGCA GCATTAAGACTTGTCAGTGAGTGTGATGGTTTT 50 83
Transcription unit	TU_178
Empirical formula (pH 7.5)	H₈₉₂C₈₀₈N₃₄₉O₅₇₈P₈₃
Molecular weight (pH 7.5; Da)	27310.51

Functional genomics
Is essential	Yes (Show evidence) Value: True Measured: Yes Species: Mycoplasma genitalium G37, Media: SP4 + 5% CO2, Temperature (C): 37.0 References Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165
Relative expression	736.872 (dimensionless) (Show evidence) Value: 736.872 Measured: Yes Species: Mycoplasma pneumoniae M129, Media: Hayflick media + 20% horse serum, Temperature (C): 37.0 References Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319
Half life	1200.0 (min) (Show evidence) Value: 1200 Measured: Yes Species: Escherichia coli NCM3416, Media: M9 media + 0.2% glucose, OD600 = 0.8, Temperature (C): 30.0 References Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387
Extinction coefficient (260 nm, 25C, pH 7.0)	830900
pI	3.84

Function
Complex subunit	signal recognition particle [c]: MG_0001 + MG_048_MONOMER ⇒ MG_0001_048

Comments
Comments	Half-live ≫ 10 minutes [PUB_0397]. Half-lives of sRNA span great range, 60 min for housekeeping and regulatory genes [PUB_0398]. Expression 25% that of ribosomes [PUB_0401].
References	Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387 Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165 Lee SY, Bailey SC, Apirion D. Small stable RNAs from Escherichia coli: evidence for the existence of new molecules and for a new ribonucleoprotein particle containing 6S RNA. J Bacteriol 133, 1015-23 (1978). WholeCell: PUB_0401, PubMed: 342486 Vogel J, Bartels V, Tang TH, Churakov G, Slagter-Jäger JG, Hüttenhofer A, Wagner EG. RNomics in Escherichia coli detects new sRNA species and indicates parallel transcriptional output in bacteria. Nucleic Acids Res 31, 6435-43 (2003). WholeCell: PUB_0398, PubMed: 14602901 Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319 Winzeler E, Wheeler R, Shapiro L. Transcriptional analysis of the Caulobacter 4.5 S RNA ffs gene and the physiological basis of an ffs mutant with a Ts phenotype. J Mol Biol 272, 665-76 (1997). WholeCell: PUB_0397, PubMed: 9368649

Metadata
Created	2012-10-01 15:07:09
Last updated	2012-10-01 15:12:37