MG509 – tRNA (LYS)
Name | ||
---|---|---|
WID | MG509 |
![]() |
Name | tRNA (LYS) |
![]() |
Cross references | CMR: MG509, BioCyc: MG509 | |
Classification | ||
Type | tRNA |
![]() |
Structure | ||
Structure |
![]() |
|
Sequence | Chromosome: Mgenitalium_Chr_1, Coordinate: 403224 (nt), Length: 76 (nt), Direction: Reverse, G/C content: 47.4%, Sequence: 1 51 GCATCTTTAGCTCAGTTGGTAGAGCAAATGACTCTTAATCATTGGGTCGT GGGTTCGATCCCCTCAAGATGCACCA 50 76 |
![]() |
Transcription unit | TU_223 |
![]() |
Empirical formula (pH 7.5) | H815C738N314O537P76 | |
Molecular weight (pH 7.5; Da) | 25029.13 |
![]() |
Functional genomics | ||
Is essential | Yes (Show evidence) |
![]() |
Relative expression | 1447.19 (dimensionless) (Show evidence) |
![]() |
Half life | 45.0 (min) (Show evidence) |
![]() |
Codons |
|
![]() |
Amino acid | LYS |
![]() |
Extinction coefficient (260 nm, 25C, pH 7.0) |
722800 | |
pI | 4.08 | |
Comments | ||
Comments | Modifications were first compiled for E. coli [PUB_0045, PUB_0055, PUB_0056, PUB_0064, PUB_0065], and then modifications generated by homologous enzymes were mapped onto M. genitalium by sequence alignment. Modification reaction kinetics were compiled from the primary literature (See Note_RNAModification). | |
References |
|
|
Metadata | ||
Created | 2012-10-01 15:07:33 | |
Last updated | 2012-10-01 15:13:55 |