MG492 – tRNA (ARG)

Name
WID	MG492
Name	tRNA (ARG)
Cross references	CMR: MG492, BioCyc: MG492

Classification
Type	tRNA

Structure
Structure
Sequence	Chromosome: Mgenitalium_Chr_1, Coordinate: 266423 (nt), Length: 77 (nt), Direction: Forward, G/C content: 50.6%, Sequence: 1 51 GTCATCATAGCTCAATAGGACAGAGTATCAGCTTGCGGAGCTGAGGGTTA CAGGTTCGATTCCTGTTGGTGACGCCA 50 77
Transcription unit	TU_146
Empirical formula (pH 7.5)	H₈₂₈C₇₅₀N₃₂₅O₅₄₂P₇₇
Molecular weight (pH 7.5; Da)	25451.40

Functional genomics
Is essential	Yes (Show evidence) Value: True Measured: Yes Species: Mycoplasma genitalium G37, Media: SP4 + 5% CO2, Temperature (C): 37.0 References Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165
Relative expression	269.144 (dimensionless) (Show evidence) Value: 269.144 Measured: Yes Species: Mycoplasma pneumoniae M129, Media: Hayflick media + 20% horse serum, Temperature (C): 37.0 References Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319
Half life	45.0 (min) (Show evidence) Value: 45 Measured: Yes Species: Escherichia coli NCM3416, Media: M9 media + 0.2% glucose, OD600 = 0.8, Temperature (C): 30.0 References Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387
Codons	`CGC` `CGT`
Amino acid	ARG
Extinction coefficient (260 nm, 25C, pH 7.0)	743700
pI	4.02

Comments
Comments	Modifications were first compiled for E. coli [PUB_0045, PUB_0055, PUB_0056, PUB_0064, PUB_0065], and then modifications generated by homologous enzymes were mapped onto M. genitalium by sequence alignment. Modification reaction kinetics were compiled from the primary literature (See Note_RNAModification).
References	Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387 Björk GR, Ericson JU, Gustafsson CE, Hagervall TG, Jönsson YH, Wikström PM. Transfer RNA modification. Annu Rev Biochem 56, 263-87 (1987). WholeCell: PUB_0065, PubMed: 3304135 Björk GR, Huang B, Persson OP, Byström AS. A conserved modified wobble nucleoside (mcm5s2U) in lysyl-tRNA is required for viability in yeast. RNA 13, 1245-55 (2007). WholeCell: PUB_0055, PubMed: 17592039 Cabedo H, Macián F, Villarroya M, Escudero JC, Martínez-Vicente M, Knecht E, Armengod ME. The Escherichia coli trmE (mnmE) gene, involved in tRNA modification, codes for an evolutionarily conserved GTPase with unusual biochemical properties. EMBO J 18, 7063-76 (1999). WholeCell: PUB_0045, PubMed: 10601028 Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165 ... 3 more Lauhon CT, Erwin WM, Ton GN. Substrate specificity for 4-thiouridine modification in Escherichia coli. J Biol Chem 279, 23022-9 (2004). WholeCell: PUB_0064, PubMed: 15037613 Samuelsson T, Guindy YS, Lustig F, Borén T, Lagerkvist U. Apparent lack of discrimination in the reading of certain codons in Mycoplasma mycoides. Proc Natl Acad Sci U S A 84, 3166-70 (1987). WholeCell: PUB_0056, PubMed: 3554232 Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

Metadata
Created	2012-10-01 15:07:32
Last updated	2012-10-01 15:13:53