MG483 – tRNA (CYS)

Name
WID MG483 View in model
Name tRNA (CYS) View in model
Cross references CMR: MG483, BioCyc: MG483
 
Classification
Type tRNA View in model
 
Structure
Structure 254658259735 MG_215 MG_216 MG_217 MG_218 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 257158 (nt), Length: 77 (nt), Direction: Forward, G/C content: 55.8%, Sequence:
1
51
GGTGCCTTAGCCAAGTGGACTCAAGGCCTGGAGCTGCAACCTCCATATCG
TCAGTTCGAATCTGACAGGCACCTCCA
50
77
View in model
Transcription unit TU_134 View in model
Empirical formula (pH 7.5) H832C754N337O538P77
Molecular weight (pH 7.5; Da) 25607.56 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
38.3397 (dimensionless) (Show evidence)
View in model
Half life
45.0 (min) (Show evidence)
View in model
Codons
  • TGC

  • TGT

View in model
Amino acid CYS View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
711900
pI 3.66
 
Comments
Comments Modifications were first compiled for E. coli [PUB_0045, PUB_0055, PUB_0056, PUB_0064, PUB_0065], and then modifications generated by homologous enzymes were mapped onto M. genitalium by sequence alignment. Modification reaction kinetics were compiled from the primary literature (See Note_RNAModification).
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Björk GR, Ericson JU, Gustafsson CE, Hagervall TG, Jönsson YH, Wikström PM. Transfer RNA modification. Annu Rev Biochem 56, 263-87 (1987). WholeCell: PUB_0065, PubMed: 3304135

  3. Björk GR, Huang B, Persson OP, Byström AS. A conserved modified wobble nucleoside (mcm5s2U) in lysyl-tRNA is required for viability in yeast. RNA 13, 1245-55 (2007). WholeCell: PUB_0055, PubMed: 17592039

  4. Cabedo H, Macián F, Villarroya M, Escudero JC, Martínez-Vicente M, Knecht E, Armengod ME. The Escherichia coli trmE (mnmE) gene, involved in tRNA modification, codes for an evolutionarily conserved GTPase with unusual biochemical properties. EMBO J 18, 7063-76 (1999). WholeCell: PUB_0045, PubMed: 10601028

  5. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  6. ... 3 more

  7. Lauhon CT, Erwin WM, Ton GN. Substrate specificity for 4-thiouridine modification in Escherichia coli. J Biol Chem 279, 23022-9 (2004). WholeCell: PUB_0064, PubMed: 15037613

  8. Samuelsson T, Guindy YS, Lustig F, Borén T, Lagerkvist U. Apparent lack of discrimination in the reading of certain codons in Mycoplasma mycoides. Proc Natl Acad Sci U S A 84, 3166-70 (1987). WholeCell: PUB_0056, PubMed: 3554232

  9. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:32
Last updated 2012-10-01 15:13:52