TranscriptionalRegulation_luxR_TU_318 – Transcriptional regulation of TU_318 by luxR

Name
WID TranscriptionalRegulation_luxR_TU_318
Name Transcriptional regulation of TU_318 by luxR
 
Regulation
Transcription unit TU_318 View in model
Transcripton factor MG_428_DIMER View in model
Binding site 552057553077 MG_447 MG_448 MG_449
Chromosome: Mgenitalium_Chr_1, Coordinate: 552557 (nt), Length: 20 (nt), Direction: Reverse, Sequence:
1
TAATGATGGACCGAGTGAAT
20
View in model
Fold‑change activity
1.0 (dimensionless)
View in model
 
Comments
Comments Canonical LuxR contains a C-terminal DNA-binding domain and an N-terminal signal binding domain. M. genitalium MG_428 contains only a DNA-binding domain. LuxR DNA-binding domain binds lux boxes with the consensus sequence A[CA]CTGTAA[AT][AT]*T[TGA]ACAG[GT]T [PUB_0505]. MG_103 and MG_447 were identified as possible LuxR-regulated genes using the consensus sequence and this procedure: Use the minimal luxR promoter given from the literature and find best hits in the M. genitalium genome Filter by those which have >10 bp identity with wildtype lux box Filter by those which have >4 bp identity with sites 3-5 and 16-18 Filter by those with an 8bp palindrome or greater Because MG_428 lacks the canonical N-terminal signal binding domain we have set the fold change activity of MG_428 on MG_103 and MG_447 to 1 (no effect). Binding site has motif A[CA]CTGTAA[AT][AT]*T[TGA]ACAG[GT]T.
References
  1. Antunes LC, Ferreira RB, Lostroh CP, Greenberg EP. A mutational analysis defines Vibrio fischeri LuxR binding sites. J Bacteriol 190, 4392-7 (2008). WholeCell: PUB_0505, PubMed: 18083819

 
Metadata
Created 2012-10-01 15:09:29
Last updated 2012-10-01 15:18:57