TranscriptionalRegulation_hrcA_TU_122 – Transcriptional regulation of TU_122 by hrcA

Name
WID TranscriptionalRegulation_hrcA_TU_122
Name Transcriptional regulation of TU_122 by hrcA
 
Regulation
Transcription unit TU_122 View in model
Transcripton factor MG_205_DIMER View in model
Binding site 236786237813 MG_199 MG_200
Chromosome: Mgenitalium_Chr_1, Coordinate: 237286 (nt), Length: 27 (nt), Direction: Forward, Sequence:
1
TTTGTAATGTTGCAACTATCTAGTTAA
27
View in model
Fold‑change activity
0.4785 (dimensionless)
View in model
 
Comments
Comments HrcA represses the transcription of the heat-shock proteins including chaperones and chaperonins [PUB_0186, PUB_0418, PUB_0419, PUB_0433]. HrcA recognizes the CIRCE motif (TTAGCACTCAAA[GC][TGC][ACGT]TT[TA]GAGTGCTAA). HrcA transcriptional regulatory activity was measured in M. genitalium [PUB_0186]. HrcA is repressed by heat, leading to derepression or increased expression of chaperones and chaperonins [PUB_0186, PUB_0418, PUB_0419, PUB_0433]. However there is no CIRCE motif upstream of this transcription unit [PUB_0186]. Consequently, we set the transcription factor binding site by setting its distance from the start codon to be the mean of that of other HrcA binding sites (61 nt). Binding site has motif CIRCE (TTAGCACTCAAA[GC][TGC][ACGT]TT[TA]GAGTGCTAA). Site responds to the condition: absence of 42C heat.
References
  1. Güell M, van Noort V, Yus E, Chen WH, Leigh-Bell J, Michalodimitrakis K, Yamada T, Arumugam M, Doerks T, Kühner S, Rode M, Suyama M, Schmidt S, Gavin AC, Bork P, Serrano L. Transcriptome complexity in a genome-reduced bacterium. Science 326, 1268-71 (2009). WholeCell: PUB_0418, PubMed: 19965477

  2. Musatovova O, Dhandayuthapani S, Baseman JB. Transcriptional heat shock response in the smallest known self-replicating cell, Mycoplasma genitalium. J Bacteriol 188, 2845-55 (2006). WholeCell: PUB_0186, PubMed: 16585746

  3. Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic Acids Res 36, D93-6 (2008). WholeCell: PUB_0419, PubMed: 17962296, URL: http://dbtbs.hgc.jp/

  4. Zuber U, Schumann W. CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis. J Bacteriol 176, 1359-63 (1994). WholeCell: PUB_0433, PubMed: 8113175

 
Metadata
Created 2012-10-01 15:09:28
Last updated 2012-10-01 15:18:56