TU_332 – MG_466

Name
WID TU_332 View in model
Name MG_466 View in model
 
Structure (Hayflick media, 37C)
Structure 569383570530 MG_464 MG_465 MG_466 MG_467
Genes MG_466 View in model
Promoter ‑35 box coordinate (nt) -49
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -19
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -16
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 569883, Length: 147, Direction: Reverse, Sequence:
1
51
101
ATGAAACGAACATACCAACCAAGCAAATTAAAGCGTGCTAAAACCCATGG
TTTTATGGCTAGGATGGCAACTGCACAAGGACGTAAAGTTTTAAGGCAAA
GACGTTTTAAAAATCGTGCTCAACTCACGGTTTCCAGTGAGCGTTAA
50
100
147
View in model
 
Metadata
Created 2012-10-01 15:09:23
Last updated 2012-10-01 15:18:44