TU_329 – MG_460

Name
WID TU_329 View in model
Name MG_460 View in model
 
Structure (Hayflick media, 37C)
Structure 563493565432 MG_459 MG_460 MG_461
Genes MG_460 View in model
Promoter ‑35 box coordinate (nt) -63
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -43
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -36
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 563993, Length: 939, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
ATGAAAGGACCTAAAATTGCAATAGTAGGATCAGGTGCTGTTGGTACTAG
TTTTCTATATGCTGCAATGACTCGTGCACTTGGTAGTGAATACATGATTA
TAGATATCAATGAAAAAGCTAAAGTTGGTAATGTATTTGATCTTCAAGAT
GCTTCCTCATCATGCCCAAATTTTGGCAAAGTAGTTGCTGGAGAATACAG
TCAATTAAAAGATTATGATTTTATTTTCATTAGTGCAGGAAGACCTCAAA
AACAAGGTGGGGAAACTAGGTTGCAGCTACTTGAAGGCAATGTAGAAATT
ATGAAAAGCATTGCCAAAGAAATCAAAAAATCTGGTTTTAATGGAGTTAC
ATTAATCGCTTCAAACCCAGTTGATATCATGTCATATACATATCTTAAAG
TTACTGGATTTGAACCTAATAAAGTAATTGGCTCTGGTACTTTACTTGAT
AGTGCAAGATTAAGATATGCAATTGCAACTAAGTACCAAATGAGTTCAAA
GGATGTACAAGCATATGTTATTGGTGAACATGGTGATAGTTCAGTAAGTA
TTATTTCATCAGCTAAAATTGCAGGACTATCACTAAAACATTTTTCTAAA
GCTAGTGATATTGAAAAAGAATTTGGTGAAATTGACCAATTTATCAGACG
CAGAGCTTATGAAATTATTGAACGCAAAGGTGCTACTTTCTATGGAATTG
GTGAAGCTAGTGCTGATGTAGCTGAACAAATTTTGAAAGATACTAAAGAA
GTTAGAGTAGTGGCTCCTTTACTTACTGGTCAGTATGGAGCGAAGGATAT
GATGTTTGGAACTCCTTGTGTACTTTCAAGAAAAGGTATTGAAAAGATCT
TGGAAATAGAACTTTCAAATACTGAAAAAGTTGCGCTTGAAAATTCAATT
AAAGTTTTGAAAGACAACATTAAACTAGCAAAGCTTTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
939
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:44