TU_328 – MG_459

Name
WID TU_328 View in model
Name MG_459 View in model
 
Structure (Hayflick media, 37C)
Structure 562811564321 MG_458 MG_459 MG_460
Genes MG_459 View in model
Promoter ‑35 box coordinate (nt) -34
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -12
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -3
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 563311, Length: 510, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGCAGTTAAGAGTTGGCCTAGGAAGCAAAAAATACCACATAAAATTAAG
GAAAGAAAGTAAAAATAAATTTTGGTTAGGCGGTGTTGATTTTGAGAATT
CTAAATATATTTATGATCTTGAAAACAGTGATGAAGTTAGTGATGTTATC
CAATTAGCAGTTGCTGATGCTTTATTTGGTGCAACTGCATTAGGTGATGG
TCATATTGTTTTCAATAAAGGAAAATCAACAGTCCAATTTAAAGGTACTG
CAAAAAAAGAAGCACCAAGAGTCTTAGCAAGAACTTACAATTTCATCAGA
AAAAACTGAATTATCAATAATATTGATATCTCCTTAGAGATTCCTCAAGA
GCAAAAGGTTGATGATTATAAACACGCTATCTTTGCTTTTATTTGTAGTG
CTTTAAGAATTTCAGAATTAACAATTAATCTCAAAGTTAGAAAACCTTTA
GACAGTAATGAAATTAATTGCTTAGCTGTTGTTTTAGTAGAACGTCAAAA
AACTAAATAA
50
100
150
200
250
300
350
400
450
500
510
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:44