TU_327 – MG_458

Name
WID TU_327 View in model
Name MG_458 View in model
 
Structure (Hayflick media, 37C)
Structure 562282563810 MG_457 MG_458 MG_459
Genes MG_458 View in model
Promoter ‑35 box coordinate (nt) -39
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -22
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -15
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 562782, Length: 528, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGGGTATTAAATCTATTGTTATTAATGAACAACAGATAGAAGAAGGCTG
TCAAAAAGCAGTTAATTGGTGCAATGCTAAATTTAATAATAAAAAGGTAA
TTGTTCTTGGCATTCTAAAAGGTTGCATCCCTTTCCTTGGCAAAGTGATA
AGTAAATTTAGTTTTGACCTCCAACTAGATTTTATGGCAGTTGCTTCTTA
TCATGGTTCACATGTACAAAAACAACCACCTAAGATTGTGCTTGATATGT
CCCATGACCCTAAAGATAAAGACATCCTTTTAATAGAAGATATTGTTGAT
AGTGGTAGATCTATTAAATTAGTTATTGATCTTCTAAAAACAAGGCATGC
TAAATCAATAACTTTAATTAGCTTAATTGAAAAGATTAAACCCAAAGCCT
TTGATATTAATATTGATTTTTCTTGTTTTAAAGTAAAAGATAATTTTTTG
GTTGGCTTTGGTCTTGACTATGATGGTTTTTATCGTAACCTACCTTATGT
TGGTGTGTTTGAACCAGACAATCCCTAA
50
100
150
200
250
300
350
400
450
500
528
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:44