TU_323 – MG_454

Name
WID TU_323 View in model
Name MG_454 View in model
 
Structure (Hayflick media, 37C)
Structure 556805558273 MG_453 MG_454 MG_455
Genes MG_454 View in model
Promoter ‑35 box coordinate (nt) -67
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -42
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -38
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 557305, Length: 468, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGTTATTTAACATTTTTACTAAAATATTATCTATATTAATTAACATGGC
ATTGATTTATAAAACTGTTGCACAAACTGAAACTGGCAGAGAAGGTAGTG
TTAAAACTTTAGATGGTTTTCAAACAAAACTTAGTTTTCCCAAACCTGAT
TTATCAGTTCAAACAGAAAATAATCCTGAGCAGTTATTTGCATCTGCTTA
TGCAAGTTGTTTTTCTCAAGCAGTAATTGTTGTTATGCAACAACATCAAT
TTAGTTTTTCAAAAAAACCAGTTGTAAGTGTTAAAGTAGAACTCCATCAA
GAAAATGGACTATTTCACATTAAGGCTGGTGTTGAATTAACTACTAATAG
TAATGACCAAGAAGTTGGTAAAAAACTAATTCAAAAAGCCCATGAAATGT
GTCCTTTTAGTCGATTGATTAGAAATGAAAACTTCCTTGGTTTAACTTTA
AATGGTATTAAGCTTTAA
50
100
150
200
250
300
350
400
450
468
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:44