TU_319 – MG_448

Name
WID TU_319 View in model
Name MG_448 View in model
 
Structure (Hayflick media, 37C)
Structure 551947553400 MG_447 MG_448 MG_449
Genes MG_448 View in model
Promoter ‑35 box coordinate (nt) -26
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -6
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -3
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 552447, Length: 453, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGAGTAAATACCAAAAAAAGAGTGAAGCTGAGCTAAAACGTACTTTAAC
CAAACTCCAGTTTGATGTAACGCAAAATGCTCACACTGAGCCACCTTACA
TTAATGAATATAACCGCAATTTTGAAAAGGGAATTTATGTTGATATAACA
TCTGGTGAACCACTTTTTATTTCAACTGATAAATTTAAATCTGGTTGTGG
TTGACCTGCTTTTTCAAAACCCATTGATAAAAATTTAATTGCTAACTACC
GTGATGAATCTCACGGAATGATAAGAACTGAAGTTCGTGCTAAAAACAGT
GATAGCCACTTGGGACATGTTTTTAATGATGGACCGAGTGAATTAGGTGG
ATTGCGCTATTGTATTAATTCTGCAGCTTTAAAATTTATTCCTTTTGAAG
AGATGGAAAAATTAGGATACAAGGATTACATCCATCTTTTTAAAAATAAA
TAA
50
100
150
200
250
300
350
400
450
453
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:44