TU_311 – MG_435

Name
WID TU_311 View in model
Name MG_435 View in model
 
Structure (Hayflick media, 37C)
Structure 540741542293 MG_434 MG_435 MG_437
Genes MG_435 View in model
Promoter ‑35 box coordinate (nt) -36
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -13
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -10
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 541241, Length: 552, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGACAAAAGCACATTACATTGATTTTTTTAAACAAGCAGCTGATAAAAA
AATTCAATGATTAAAAGAAGAGTTAACAAAGATTAGAACAGGTAGGCCAA
ATCCTAAAATCTTTGATAATCTTTTGATTGAAAGTTATGGACAAAAAATG
CCTTTAATATCTTTAGCTCAAGTGACTATTAATCCGCCAAGAGAAATAAT
CATAAAACCATTTGATCCTAAGAGTAATACTAATGCTATTTACAGTGAAA
TTCAGCGGGCAAACATTGGTGTTCAACCAGTTATTGATGGTGAAAAAATT
CGTGTTAATTTTCCCCAAATTACTCAAGAAACTCGCTTAGAAAATATTAA
GCACGTTAAAAAAATAATAGAGCAAATTTATCAAGAACTGAGGGTTGTAA
GAAGAGATGCATTACAAATGATTAAAAAAGATAATCACAATGAGGATTTA
GAAAACTCTTTAAAAGCTGAAATAGAAAAAATTAACAAAAATTATTCTAA
TCAATTAGAAGAGATTCAAAAAGACAAAGAAAAAGAATTGCTAACAATTT
AA
50
100
150
200
250
300
350
400
450
500
550
552
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:44