TU_310 – MG_434

Name
WID TU_310 View in model
Name MG_434 View in model
 
Structure (Hayflick media, 37C)
Structure 540010541742 MG_433 MG_434 MG_435
Genes MG_434 View in model
Promoter ‑35 box coordinate (nt) -59
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -33
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -27
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 540510, Length: 732, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
ATGCACAAATCAAACAATAAAATCCGCCAAAGAATAATCATTAAACTTAG
TGGTGCTGGGCTAACCAAAGAAAATTCTCAACCCTTTTCTAATGATTTTT
TTGAAACTATTATTAATCAATTAAAAGTTTTAAAAGAAAGCTATCAAGTA
GGAATTGTTATTGGTGGGGGTAACATTATCAGAGGTAATAATTGCCAAGA
ATTTAACATTGCTGAATACCATGGTCATCAACTTGGTATTATAGCAACAG
TAGTTAATGGCTATTTTTTAAAAGCAAAGTTAGATGCACATAATTTGAAA
AGTGCTTTACTAAGTGCAATTAGTTGTCCTAGTTTAGCAGTGCAAATTCT
TTCACAGCAAACTATTGATAAAGCTTTTGAAGAGAATGACTTTGTCATTT
TTTCAGGTGGCACTGGTAATCCTTATTTTTCCACTGACACTGCATTAGCT
TTAAGAGCAGTGCAAACAAAAGCAGTTGCTATTCTGATTGGAAAAAATGG
TGTTGATGGTGTTTATACAGCTGATCCTAAAAAAGATAAAAATGCAACCT
TTTTACCAACACTCAACTATGACCATGCCATTAAAAATGATTTGAAAATT
ATGGATATTACTGCTTTTACTATGTGTAAGGAAAATAATCTGAAAATAAT
TATTTTTAACATTAATGCTGAGAATGCATTATTAGATGCATTAAACAAAA
AAGGTCGCTTTACTATAATTGAAAATAACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
732
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:44