TU_306 – MG_428

Name
WID TU_306 View in model
Name MG_428 View in model
 
Structure (Hayflick media, 37C)
Structure 533307534823 MG_427 MG_428 MG_429
Genes MG_428 View in model
Promoter ‑35 box coordinate (nt) -55
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -28
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -25
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 533807, Length: 516, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGAAAAATAATATTAGTGATGTAAAGTTGGGACTGTTAGCAGCAAAAAT
TTATTGAAAATCTTGACGCTTTTTAGAGTTAACAGAAGATGACATTATCT
CTATTGCACTTCATGCAGAGCAAGATTCTAAGAAGCGTTTTAATCCTGAA
TTTGGCTTAAGTTTTGACAACTATCTCAAATTAAATGGAGCAAATTTCAT
TAGATCAAGTTTTAGAAGTATGGTGAATAAAGTTGAATTGCTTGATTCTA
AAAGTAAATACTCATTAGAAAAGCAAAACACAGTTCTAAATACACCTGAA
AACTATTTACGGAGTTTAGAATTTAAAGAAATTATTACTAAAGCTTTTAA
TAAAGCTAAAAACGATCAAGAGAGAAAAGTTTTTTCTTTATATGTAAAGG
GCTATAAAAACTTTGAGATAGCAAAAAAGCTCAATATTAGTCCTAGAAGA
GTGAGATATTTATTAGATCTTTTTAAAAGCTACATCAAATTGCTAACAGA
AAGATATGGATATTAA
50
100
150
200
250
300
350
400
450
500
516
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:43