TU_305 – MG_427

Name
WID TU_305 View in model
Name MG_427 View in model
 
Structure (Hayflick media, 37C)
Structure 532771534197 MG_425 MG_426 MG_427 MG_428
Genes MG_427 View in model
Promoter ‑35 box coordinate (nt) -53
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -28
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -22
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 533271, Length: 426, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
ATGGATAAAAAATACGATATCACAGCTGTTTTGAACGATGATAGTTCTAT
TAATGCAGTAAGCGATAACTTCCAAATAACACTGGATGCACGACCAAAAG
AAAAATCTAAAGGCATTAATCCTCTGTCAGCTTTTTTGGCTGGTTTAGCT
GCATGTGAACTTGCAACTGCTAATGCGATGGCAGCTGCTAAGATGATAAC
TTTGAACAAGGCACTGATTAACATCAAAGGTTATCGTTTAACAAATCCTA
GTGATGGTTATTTTGGCCTACGTGAACTTAACATTCACTGAGAAATTCAC
TCTCCTAATGAGGAAGAAGAGATTAAAGAATTCATTGATTTTGTAAGTAA
ACGTTGTCCTGCTCATAACACTTTGCATGGAACTAGCAATTTTAAGATAA
ATATTAGCGTTACTTTAGTCCACTAA
50
100
150
200
250
300
350
400
426
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:43