TU_304 – MG_426

Name
WID TU_304 View in model
Name MG_426 View in model
 
Structure (Hayflick media, 37C)
Structure 532541533736 MG_425 MG_426 MG_427
Genes MG_426 View in model
Promoter ‑35 box coordinate (nt) -36
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -9
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -5
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 533041, Length: 195, Direction: Forward, Sequence:
1
51
101
151
ATGGCAAAAAAAGACCAACTTACCTTAAGAGGGCCTTTGTATGGCAATAA
TCGTTCTCATTCCAAAACTATTACAAGAAGAAAATGGAATGTAAACCTTC
AGTCATGCAAAATTAAAGATACTAATGGTAAAGTAACACGGATTCTAGTT
TCAACTAAAACAATTCGTACCCTTAAAAAACAAAATCGTTTCTAA
50
100
150
195
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:43