TU_302 – MG_424

Name
WID TU_302 View in model
Name MG_424 View in model
 
Structure (Hayflick media, 37C)
Structure 530720531981 MG_423 MG_424 MG_425
Genes MG_424 View in model
Promoter ‑35 box coordinate (nt) -47
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -20
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -17
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 531220, Length: 261, Direction: Reverse, Sequence:
1
51
101
151
201
251
ATGAAAATTGATAAAGAACAAATCATTAAGGCTCATCAACTTCACAAAAA
CGATGTTGGCAGTGTGCAAGTACAAATCTCTATATTAACAGATCAGATTA
AAAAATTAACAGACCACCTGTTAGCAAACAAAAAGGATTTTATTTCTAAG
CGTGGTTTATATACAAAGGTATCAAAAAGAAAACGGCTACTTAAATATCT
AAAAGAACGTAATATTGAAACCTACCGTGATTTGATTAAAAATTTAAACC
TCCGGGGTTAA
50
100
150
200
250
261
View in model
 
Metadata
Created 2012-10-01 15:09:22
Last updated 2012-10-01 15:18:43