TU_294 – MG_407

Name
WID TU_294 View in model
Name MG_407 View in model
 
Structure (Hayflick media, 37C)
Structure 508960511337 MG_406 MG_407 MG_408
Genes MG_407 View in model
Promoter ‑35 box coordinate (nt) -56
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -26
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -18
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 509460, Length: 1377, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
ATGGGAAGTTCAAATCTAAACATCAATTCAAAAATAACCGATATTTTTGC
TTATCAAGTTTTTGATTCTCGGGGTGTTCCAACAGTAGCTTGTGTTGTTA
AATTGGCATCTGGTCATGTAGGTGAAGCGATGGTTCCATCAGGTGCTTCT
ACAGGTGAGAAAGAAGCAATTGAATTACGTGATAATGATCCAAAAAATTA
TTTTGGTAAAGGCGTTAACGAAGCCGTTGATAACGTTAATAAAGTTATTG
CCCCTAAGCTTATTGGCTTAAATGCATTTGATCAATTAACAGTGGATCAA
GCAATGATTAAACTAGACAATACTCCCAACAAAGCAAAATTAGGAGCAAA
TGCTATATTATCTGTTTCACTTGCAGTATCAAAAGCAGCAGCAAAAGCAC
AAAACAGCTCATTATTTCAATACATTTCAAATAAATTAATTGGATTAAAT
ACAACAAATTTTGTTTTACCTGTGCCAATGTTAAATGTAATTAATGGTGG
TGCTCATGCTGATAACTATATTGATTTTCAAGAGTTCATGATCATGCCTT
TAGGTGCTAAAAAGATGCATGAAGCTTTAAAAATGGCTAGTGAAACTTTT
CATGCTTTACAAAATCTTTTAAAAAAGCGTGGATTAAACACAAATAAAGG
AGATGAAGGTGGATTTGCGCCTAACTTAAAACTTGCAGAAGATGCACTTG
ACATCATGGTTGAAGCCATTAAATTAGCTGGATATAAGCCTTGAGATGAT
ATTGCTATTGCCATTGATGTTGCTGCTAGTGAGTTTTATGACGAAGATAA
AAAACTTTATGTTTTCAAGAAAGGAATAAAAGCTAATATCCTTAATGCAA
AGGATTGGAGTTTAACAAGCAAAGAAATGATTGCTTACTTAGAAAAATTA
ACAAAAAAATATCCAATTATTTCAATAGAAGATGGTTTGAGTGAAAATGA
TTGAGAAGGGATGAACCAATTAACTAAAACCATAGGTAGCCATATTCAAA
TTGTTGGTGATGACACTTACTGTACTAATGCAGAACTTGCTAAAAAAGGT
GTTGCACAAAATACAACAAACTCGATATTGATTAAATTAAATCAAATTGG
TTCTATTAGTGAAACGATTCAAACAATTGAAGTTGCAAAAAAAGCTAACT
GGAGTCAAGTAATTTCACATCGCAGTGGTGAAACAGAAGATACAACTATT
GCTGATTTGGCAGTTGCTGCCCAAACTGGTCAAATTAAAACCGGTTCAAT
GTCACGCTCAGAAAGAATAGCTAAATACAATCGTTTGTTGTACATAGAAA
TTGAACTTGGTGATAAAGGAAAATACTTAGGTTGAAATACCTTTACAAAC
ATTAAACCTAAAAACTTTAACATCTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1377
View in model
 
Metadata
Created 2012-10-01 15:09:21
Last updated 2012-10-01 15:18:43