TU_289 – MG_398

Name
WID TU_289 View in model
Name MG_398 View in model
 
Structure (Hayflick media, 37C)
Structure 501922503324 MG_397 MG_398 MG_399
Genes MG_398 View in model
Promoter ‑35 box coordinate (nt) -46
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -29
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -26
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 502422, Length: 402, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
ATGAAGTTATTGCGCTTTTTGGTACTTAGTCCTAGTGGCATAAAACTAGA
TAAAACCATTATTAGTGCGCAAGTTAAAACTACTGAAGGTTACATAGGAT
TAAATTTTAATCGCGCTCCTTTGATTGCTGCTATTCAATCCCATCTGTGC
AAAATTATTTTTGCTGATCAAACAAAAAGAGAAGCAATTATTGGTGCTGG
TTTAATGCTTATTAAAAAAACAGAAGCTAAGATTTTCACAGAAAATTTTG
TTTTTGCTGATGAAGTTGATATTAATGAAACCTTAAAAAGAAAAACAGAA
CTTGAAAGAAAAATTCACCATATCAAGGATGCTAAGCTAAACGTTAAAAT
TGAACAAAATTTAATGTTTGAACTATTAAAACTTTCAAGTAAGAAAAAAT
AA
50
100
150
200
250
300
350
400
402
View in model
 
Metadata
Created 2012-10-01 15:09:21
Last updated 2012-10-01 15:18:43