TU_283 – MG_389

Name
WID TU_283 View in model
Name MG_389 View in model
 
Structure (Hayflick media, 37C)
Structure 490647492031 MG_388 MG_389 MG_390
Genes MG_389 View in model
Promoter ‑35 box coordinate (nt) -72
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -46
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -39
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 491147, Length: 384, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
ATGAAGCAGAAAATTTTAGGAATAACAATTGCTTTTATTATTTTGCTTTT
AACAACAGTTGCTATCTTGTTTTCAGTAAAGGTAAAACAATATCTTAATG
TAAATCTTTGAACTACGCAACAACAAAATTTTTTAATGTTTAAAAATGAA
AAAGATGAAAATCTTTTTAACAACGTTTCATGGACTAATTTTCAAGCAGA
AACAACAGAAAAATCAGCAAAAAAAGCTTTTAGACTTTACAAAAAGAAAA
TTTCTACATCAGAAATTTCATCAGAATTGAACAAAAATCTAGTAAAGGTA
GATTTAAGTGTTACTCTAGAACAGGGCTGATATAATATTACTATCATGTT
ACCATCAAAAGATTTGTTTGAAGTCATCTTTTAG
50
100
150
200
250
300
350
384
View in model
 
Metadata
Created 2012-10-01 15:09:21
Last updated 2012-10-01 15:18:42