TU_277 – MG_382

Name
WID TU_277 View in model
Name MG_382 View in model
 
Structure (Hayflick media, 37C)
Structure 480191481833 MG523 MG_382 MG_383
Genes MG_382 View in model
Promoter ‑35 box coordinate (nt) -69
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -48
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -45
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 480691, Length: 642, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGGATGAAAAAGGGATTTTAGTTGCAATTAGTGGTGGTAGTTGCTCAGG
AAAAACTACTGTTGCTGAAATGATTTATCAACTTTTAAGTAAAAAATTAA
AAGTTGCGATCATCTGTCAAGATAACTATTACAAGTCCTATAAAAATAAG
CCATTATTAAAAAGAAAAACAATAAACTTTGATCATCCTGATGCTTTTGA
TTGAAAACTTTTAAGATCACACATTGAAGATCTTCTAAACGGTAGTATAG
TTAATGTTCCTTTATATGACTACATTAACTATACCAGAGCTAAAAAAACA
GCAAAAATTGGTCCAATTGATGTTGTTATTCTAGAGGGTTTAATGCCATG
ATTTGATGAAAAATTATCAAGACTTTCTAAGCTAAAAATATTTATAGAAA
CAAATGGGGAAGAACGTTTAATTAGAAGAATAGAAAGAGACTGACAAAGG
GGAAGAAATATTGATTCTATTATTAAACAGTGACGCGAAATAGTAGCACC
AATGTATGAAATATTTGTAGAAAAAATGAAGCGAAATGCTGATTTAATTC
TGCCTTGAAGTCAACGCAGAGAAGTAAGTACAAGTGTATTGGATGTCGCA
ATTGAACACTTATTTCACAAAACTGTTGAAAAAAATAATTAG
50
100
150
200
250
300
350
400
450
500
550
600
642
View in model
 
Metadata
Created 2012-10-01 15:09:21
Last updated 2012-10-01 15:18:42