TU_276 – MG523

Name
WID TU_276 View in model
Name MG523 View in model
 
Structure (Hayflick media, 37C)
Structure 479740480816 MG523 MG_381 MG_382
Genes MG523 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 480240, Length: 76, Direction: Reverse, Sequence:
1
51
GCGTCGGTAGCTCAGTGGATAGAGTACACGCCTTCTAAGCGTGTTGTCGT
GGGTTCAAATCCCTCCCGATGCGCCA
50
76
View in model
 
Metadata
Created 2012-10-01 15:09:21
Last updated 2012-10-01 15:18:42