TU_273 – MG_377

Name
WID TU_273 View in model
Name MG_377 View in model
 
Structure (Hayflick media, 37C)
Structure 474398475980 MG_375 MG_376 MG_377 MG_378
Genes MG_377 View in model
Promoter ‑35 box coordinate (nt) -37
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -20
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -17
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 474898, Length: 582, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGGCTACTAATCTTAAATCTATTGCAAAGTTGCAAAAACCTATTCAGTA
TGATAAGGTAATTGAAGTTGATCGTATTTTTGCAGATCCTGCTTTTATTG
AGCAACATCGGCAAAGAATTTTAGCTTCTTTTAAAGATGCTAAGGAAAGT
GCTCTTTACCACGAACTAACTCATATTGTTATTAAAGATAATTTGTTTTC
AGCAGCAATGAATGAAATTGTTAGTTATTTTGAATTTCAAATTAACCCTG
AAGAGTTAAAAAATGTTGTTGAAGGCTTGAAAAGAGATGTTGTTAAAGAT
GCTGATGAAAAAACAATTCAATCAATAGCTGAAAAAATCATTAAAAAAGC
TTTAGTATTTAATTTCTTACAAAAGGAATGAAAGGTTGAAGTTAGTGATG
ATATTGTTAAAAGAGTTATTAGCTTGTATTATGAAAAAACTAATCAGAAT
GTTAGAGAATATCTTGATGATAAACAAAAGTTTGAAGGTATTAGAACTGC
ATTAATAGAAGAAAGAATGGTTTTAGAAACAATTAACCACTTTAAATTTC
ATTTCAACTTAACAGGTCAATTACCTAGCTAA
50
100
150
200
250
300
350
400
450
500
550
582
View in model
 
Metadata
Created 2012-10-01 15:09:21
Last updated 2012-10-01 15:18:42