TU_272 – MG_376

Name
WID TU_272 View in model
Name MG_376 View in model
 
Structure (Hayflick media, 37C)
Structure 474078475393 MG_375 MG_376 MG_377
Genes MG_376 View in model
Promoter ‑35 box coordinate (nt) -61
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -40
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -32
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 474578, Length: 315, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
ATGTTAAATTGCGTTTTTTTGGAAGGTGAAATAGAAAGCACAAAGTGAAG
CCACAAAAAGACAGGATTTTTAGTAACTATTAAGCAGAAACGTTTGTTTG
GTGAACGAAGTTTTACTGATTTTTTTGTTTTTTATGCAAATGGTCAATTA
GCATTTGAACTTGAAGCATATACTCAAAAATTTAAAACAATTAGCATCGA
AGGTATTCTGCGCACTTACCTAGAAAAACGCAGTGGAATTTGAAAAACAA
CAATCGAAGTTGTCAAAATTATGAAACCAAATTCAAAAGTAATGATTGAT
TATCAAGAATCTTAA
50
100
150
200
250
300
315
View in model
 
Metadata
Created 2012-10-01 15:09:21
Last updated 2012-10-01 15:18:42