TU_264 – MG_522

Name
WID TU_264 View in model
Name MG_522 View in model
 
Structure (Hayflick media, 37C)
Structure 460185461452 MG_362 MG_363 MG_364 MG_522
Genes MG_522 View in model
Promoter ‑35 box coordinate (nt) -47
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -21
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -14
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 460685, Length: 267, Direction: Reverse, Sequence:
1
51
101
151
201
251
ATGGCTAATATTAAATCTAACGAAAAACGATTACGTCAAGACATTAAGAG
AAATTTAAATAATAAAGGACAAAAAACTAAACTAAAAACTAATGTTAAAA
AATTTAATAAAGAGATTAATTTAGATAATCTCAGTTCTGTTTATTCTCAA
GCAGATCGTTTAGCCAGAAAAGGGATTATTTCTTTAAACAGAGCTAAGCG
TTTAAAATCAAAAAATGCTGTTATTTTGCATAAAAGTAATACAAATTCAA
CTGCAAAAAAACAATAA
50
100
150
200
250
267
View in model
 
Metadata
Created 2012-10-01 15:09:21
Last updated 2012-10-01 15:18:42