TU_263 – MG_361 - MG_363

Name
WID TU_263 View in model
Name MG_361 - MG_363 View in model
 
Structure (Hayflick media, 37C)
Structure 459115461171 MG_360 MG_361 MG_362 MG_363 MG_364 MG_522
Genes MG_361, MG_362, MG_363 View in model
Promoter ‑35 box coordinate (nt) -58
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -37
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -31
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 459615, Length: 1056, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
ATGGTAGATAGTAAGAAAAATAAAAAACAGCAGGTTACGGATTTTTCTAA
TTTACTCTCTCAAAGTAAAGGATTTGTTATTTTTGACTATTCAGGAATGT
CTGCTGTTGATGCAACTTTAATGAGAAAAAAGTTGTTTAATAAGGGTAGT
AAGATAAAAATTGTTAAAAACAATATCTTAAGACGTGCTTTAAAAACTAG
TAATTTTGAAGGTGTTGATGAATCGGTCATCAAAGGAAAAATTGCAGTTG
CTGTTGGTATTAACGAGATCTTAGAAACCTTAAAAGTTGTTGATAGTGTA
GTTAAAGAAAAAGAGTTAATGAAATTTGTTTGTGGTCATTTTGATAACCG
TATTTTTAATAGTGATGACTTACAAAAAATAGCAAAACTCCCTGGTAGAA
ATGAACTTTATGGAATGTTTCTTTCAGTTCTACAAGCACCATTACGAAAA
TTTCTCTATGCTCTTCAGGCAGTAAGGAATGCTAAGTAAATTAAATAAAT
AGAAAAATATTATGGGAAAACTAGATAAAAAACAATTAATTGAATCTCTA
AAAGAGATGACTATAGTTGAAATTGATGAAATAATCAAGGCTGTTGAAGA
AGCATTTGGTGTAACTGCAACTCCAATAGTAGCTGCTGGCGCAGCTGGTG
CTACACAAGAAGCTGCTAGCGAAGTTAGTGTAAAGGTAACAGGATATGCT
GATAATGCTAAGTTAGCTGTTTTAAAACTTTATCGTGAAATTACTGGAGT
TGGTTTAATGGAAGCTAAAACTGCAGTTGAAAAATTACCTTGCGTTGTAA
AACAAGATATTAAACCAGAAGAAGCAGAAGAACTTAAAAAGCGTTTTGTT
GAAGTTGGTGCAACTGTTGAAGTTAAATAAAGATGGCAGTACAACAACGG
CGTTCTAGTAAACACCGTCGTGATAAAAGACGTTCTCACGATGCACTTAC
TCTACAAACTTTAAGTGTTTGTAAGAAATGTGGTAAGAAGAAGTTATCAC
ATCGTGTGTGCTCTTGTGGTATGTACGGTGAACTAAGAGTTAAAAAAGCT
CACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1056
View in model
 
Metadata
Created 2012-10-01 15:09:21
Last updated 2012-10-01 15:18:42