TU_261 – MG_358 - MG_359

Name
WID TU_261 View in model
Name MG_358 - MG_359 View in model
 
Structure (Hayflick media, 37C)
Structure 456255458771 MG_358 MG_359 MG_360
Genes MG_358, MG_359 View in model
Promoter ‑35 box coordinate (nt) -241
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -217
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -214
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 456755, Length: 1516, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
ATGATTACATCTATCTTTGGAAAAGTTACTTTTGTAGGCAAAAGAAAAAT
AATTGTTGAGCACAACTGGATTTCATATTGATTTAATACAAAAGAAAACC
ATAAATTTGAAAAAAATTTGGAAAAAAATAAGCAAATTTTTTGTCATATT
ATTAAAAAAATTGTCGCTAACCAAATTATAGAAGAGGCTTTTGCCTTTAA
TACTCTAGAAGAAAAAGAGTGGTTCTGTAGATTAATAGAACTCAATGGTA
TTGGTAGTAAAACTGCACTTAATTTGCTCAATAATGACCTTGAGGAAATT
AAACAATACATTCTGGAAAATAACTACAGTGCATTATGTGGTATTAACGG
TGTAAATAACAAAATAGCTCGTGCACTTTTATCACTTGAAATATTTGAAA
AATCTGAAAATAATAAAAATATTAAAGGAGTTCAAGTTGCTGATGGTTAT
GATGAATTGTTTGAAACACTAAAGTCACTTGGTTACAAACAACAAGAAAT
TCAGGATGCACTAAAAATGATAGAAGTAAAACCTGATTTTGATATAAGTC
AGTTAGTTGCAGAAGTAATTAAATTAATGTCTTTTAAGAATAATGAAATT
ACAAATAAAACCGCCTAATACCTTTGATGAATTTGTAGGAAAACAAGAAA
TAATTAGTCAAATTCAATTAAGTATTAAAGCATCTAAATTAAATAAAACA
CAACTAGATCATATCTTGTTATATGGCCCACCTGGTGTGGGTAAAACTAC
TTTAGCCAGATTAATAGCAAATGAATTGAAAACAAAGTTGCAAATTATTC
AAGGTGGACATTTACAAAAACCAAGCGATTTCTTAAACGCAATTTCACTC
ATTAAAAAAGGTGATGTTCTTTTTATAGATGAGATCCATGCCGTAGCACC
TAATGTCATGGAACTAATGTATCCAGTTATGGATGTGTTCAAAATACAAG
TATTAATTGGCAAGGATTTTAATTCCAAGATAGTTGAAATGAAGGTAAAT
CCTTTTACTCTAATTGGTGCAACTACACAACTTGGTAAAATCATCAATCC
TTTAGAAGATAGATTTGGCGTTATCTTAAACATTAACTATTATTCAAATG
CTGAAATTGAAAAGATGGTAAGTATCTATGGAAAGCAAATGAAGTTAGAG
CTAAATTCAAATGAAATTTCAGCTATCACTGAACATAGTAAACAAACACC
AAGAATTGCAATTAGAATAGTTAGAAGAATATTTGAACAAAAAATTGTTA
ATAAAAAAATAGACCTTGAGGGTTTGTTTAAGAATTTAATGATTTATAAA
AATGGTCTGCAAAGTATTGATGTCCAATATCTTGAGGTTTTAAATCGCCA
AAATGAACCACAAGGAATTAAGTCAATTAGTTCCATGTTAGGTATAGACA
GACACACTATAGAAAATAAAATTGAACCTTTTTTGTTGCGTGAAAATATG
ATTCAAAAAACCAAAAAAGGCAGGATTATTACAAATAGCGGAAGAGAATA
TTTAGTTAACTTTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1516
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:42