TU_259 – MG_356

Name
WID TU_259 View in model
Name MG_356 View in model
 
Structure (Hayflick media, 37C)
Structure 453411455254 MG_355 MG_356 MG_357
Genes MG_356 View in model
Promoter ‑35 box coordinate (nt) -37
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -15
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -7
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 453911, Length: 843, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGGATTTAAAAAAAGCGGTTGCTTTTCTTTGTGAAAAACTTCAAGTTGT
AGAAACAGATATTTTCAAGATAGAGCAAATTCATTCTGGTTTTACTAATT
TTTCTTTTTTTTGTGAATTGAAAGATCATAGTAAATTTCAAATAAGACTT
TCAAGAAAAGATGTTATTTTAGACAGAAGAAATGAACAAATTATTTTGCA
ACTAGTAGAACCTTTTTTTTCAAACCCATTTGTTTATTTTGATGTAACAA
CAGGTAATGCTATAAAAAGGTGGATAGAAGGCACTCAACCTAAAAGAGCA
ACTGATCTATTTTTATGCAGATTGGTTGAATCTTTAAAAAAAGTTCATTC
AGTTGACTGAAAACCATTTGCTAATGAACTTTTAATATTTGATCCTTTGG
TTTATTTTGAAAAAACTAAGCTTTCCGCTTTTTATAAACGGTTATATCTT
AATTTAACTAAGAAGCATATTGACATACCAAAAACTCTCTGTCATCATGA
TGCTACTTTTGATAATTTGGTTTGAACACCTAAAAAGCAAGTAATCCTTA
TTGATTTTGAATGATCTTGTGTTGATAATCCTTATTATGAAATAGCTAAT
ATTATTCGTGAAGAACTAACCATAGAAACAGCAAATAAACTTATTGATAT
TTATGGTGGACTTAAGCGTAAGCTTGTTTTTGAAACAGTTATTTATGTTT
TATTATTTGCTTTTCAATGAACTGAGATTATGCCCCAAACAGAAGCAATT
TTAAACTATCGAAAATGAGTTGAAAAACGATTAGAATACTTTTTAAAAGC
ATTATTTCCCTCAATTTGAAAACAAGCACAAAAAAATAGTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
843
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41