TU_257 – MG_354

Name
WID TU_257 View in model
Name MG_354 View in model
 
Structure (Hayflick media, 37C)
Structure 450697452111 MG_353 MG_354 MG_355
Genes MG_354 View in model
Promoter ‑35 box coordinate (nt) -59
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -29
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -23
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 451197, Length: 414, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
ATGGAACAAAACAATATTAAAGAACAACTTATTTCTTTCTTTAATCAAGC
ATGTTCTACCCACCAAGAAAGACTTGATTTTATCTGTTCTACAAGAGAAA
GTGATACTTTTTCTAGTGTTGATGTACCACTTGAACCCATTAAAAATATT
ATTGAAATAACTAAAGATGAAAATCAACAAATTGAAATTACAAAAATAGC
TGTTAATAACATTAAAACATTATCTTCTGTTGGTGCAACCGGTCAGTATA
TGGCATCTTTCTTTTCAACGAATAGTGAGCCAGCTATAATATTTTGCGTC
ATTTATTTTTTATATCACTTTGGTTTTTTAAAAGATAACAATAAAAAACA
AATAATAAAAAAGGCTTATGAAACTATTGCTGATAACATTGCTGACTATT
TAAATGAAAATTAG
50
100
150
200
250
300
350
400
414
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41