TU_256 – MG_353

Name
WID TU_256 View in model
Name MG_353 View in model
 
Structure (Hayflick media, 37C)
Structure 450219451549 MG_352 MG_353 MG_354
Genes MG_353 View in model
Promoter ‑35 box coordinate (nt) -58
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -35
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -28
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 450719, Length: 330, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
ATGGAAAAAACATCAAATACAAGTAAGCCACTTTCTCGTAGTGAAATCAA
TAAAATAATTGCAGTTGCTACTGGTATAAAAGAAAAAAAAATTAAGGAAA
TCTTTAAATACCTTAACACATTGTTACTAAATGAATTGGTAAGTAGAAGT
GTTTGTATATTACCTGAAAATTTAGGTAAATTAAGGATTACTATTAGAAA
TGCACGTTATCAGAAGGATATGCAAACAGGTGAGATTAGACATATCCCAC
CAAAACCATTAGTGCGCTACAGTCCAAGCAAAACGATCAAAGAAACTGCA
GCTAAAGTGCGTTGAAAGTACGCAGACTAA
50
100
150
200
250
300
330
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41