TU_254 – MG_351

Name
WID TU_254 View in model
Name MG_351 View in model
 
Structure (Hayflick media, 37C)
Structure 449165450720 MG_351 MG_352 MG_521
Genes MG_351 View in model
Promoter ‑35 box coordinate (nt) -73
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -52
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -49
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 449665, Length: 555, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGGACAAATTTTTAATTGATGTTATTGTAGAAATCCCTAAAAACAGCAA
AATAAAGTATGAGTATGATCGTCAAACTGGTCAAATTCGCGTTGATAGAA
TCCTATTTGGAAGTGAATCATATCCACAAAACTACGGTTTTATTAAAAAT
ACATTAGATTGAGATGGGGATGAACTTGATTGTTTTATCTTTGCAGATCA
ACCATTTTTGCCTGCAACAGTTGTGCCTACAAGAATTGTAGGAGCACTTG
AGATGATTGATGATGGGGAAATTGATACTAAGTTATTAGGAGTTATTGAT
TGTGACCCTAGATATAAAGAAATTAATCAAATTAGTGATTTACCTAAACA
TAGAATAGAAGAAATTCTTATCTTTTTAAAAACTTATAAATTACTTCAAA
AAAAGACTGTAATTATTAAGGGTTTAAAAGATGTTTGTTGAGCTAAAAAA
GAATATGAAATTTGTTTGCAATTAATGAAAGATTATGGTCATTTATCAAA
AGATCAATTTATCCAAAAAATGCAAATTCTTCATCCAGAACATTACCAAA
AGTAA
50
100
150
200
250
300
350
400
450
500
550
555
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41