TU_252 – MG520

Name
WID TU_252 View in model
Name MG520 View in model
 
Structure (Hayflick media, 37C)
Structure 448283449365 MG520 MG_350 MG_521
Genes MG520 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 448783, Length: 82, Direction: Forward, Sequence:
1
51
CCTGGAGTGGCGGAATGGTAGACGCGGTGGACTCAAAACCCACTAGGAAA
CTGTAGGAGTTCAAGTCTCCTCTCCAGGACCA
50
82
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41