TU_250 – MG519

Name
WID TU_250 View in model
Name MG519 View in model
 
Structure (Hayflick media, 37C)
Structure 445678446766 MG519 MG_348 MG_349
Genes MG519 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 446178, Length: 88, Direction: Reverse, Sequence:
1
51
GTCGGAGTGGTGGAATGGTAGACACGCAAGCTTGAGGTGCTTGTGGTCGT
TAAAGACTGTGCCAGTTCAAGTCTGGTCTCCGACACCA
50
88
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41