TU_249 – MG_348

Name
WID TU_249 View in model
Name MG_348 View in model
 
Structure (Hayflick media, 37C)
Structure 444697446666 MG519 MG_347 MG_348
Genes MG_348 View in model
Promoter ‑35 box coordinate (nt) -64
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -44
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -39
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 445197, Length: 969, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
ATGAAGCGTCTTTTTTGAAATCTAAAACATAAAAAAGCATGGTTAGTTTT
ATTACTAGGAACAGGAATGATTTTAAGTTCTTGTAGTAACATCGATCAGT
CTTTTTTTCGTGAACTTTCTGTTGAAAGTGTGGAAAAAAATACAGCTTAC
AACCAATTGCCTGTTAACAGTACAACATTTAGAAACTTAGTTTTTGGAAC
CAGATCATATAACGATGGTAATTATGTGGTTGTTATTGCAACCGAAACAG
ATAGTTCCCAAATTAATTTTCTAAACGGTTCTACTAATCAAGGTACAAGT
TCTCTTAGTTGAGGAGGTACCTTGGGTACCACCATCAGACAGGTGCAAAA
CCGTTATTCTACTTATCCAAACGGAGTTAAATTTTTAATTTGGAATGATA
TTGCTCCTGGTTCAGTAAAGTGAAACCCATATGCACGTTTTCCTGTTGTG
GATAGAAAAAACGAACTTGCAAGTCAAGAAGATAAAGACAATTCCAATAA
GTTAAGAAGATCAGATGCTTCTGCAGTTCGCTATAGAGAAATAGTTGATT
TTATTCAACGTACTTATGGTGGTAATGTAGCTAACTTAATCAATCAATCA
AATGTGCATGCTCAAACAGTTGGTAATGATGTAACTAAAGCAATTGTGAT
TGCTTTTAGAAAAGATAACCTTAATAAGATAAGAGCTAATTTTTATGGTT
TGGATAACTCTACAAATCCTAATGCACCTGGATCAGGTCAGGGTGATTCA
ACCCCACCAGCTTCAAGTGGTGAAGGGGGCGGTAGTGATGGCAGTTCAGG
TGGTGACTCAAGTAGTGGTAATGGACAAAATACTACTCCTACTTCACCAC
AATCTTCTCAACCAGCAGTTCAAAGATCACAAAAATCTTATGGAATTAAA
CAACACGCAGTAAGAGTTAGTGTTGATTTTTTAAATTTCTTGGATAGTGT
TTATACTCCACTAAACTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
969
View in model
 
Regulation
Regulation TranscriptionalRegulation_fur_TU_249: MG_236_MONOMER View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41