TU_248 – MG518

Name
WID TU_248 View in model
Name MG518 View in model
 
Structure (Hayflick media, 37C)
Structure 444578445654 MG518 MG_347 MG_348
Genes MG518 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 445078, Length: 76, Direction: Forward, Sequence:
1
51
GCGATTGTGGCGAAGTGGTTAACGCACCTGATTGTGGATCAGGCATTCGT
GGGTTCAATTCCCATCAGTCGCCCCA
50
76
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41