TU_243 – MG_342

Name
WID TU_243 View in model
Name MG_342 View in model
 
Structure (Hayflick media, 37C)
Structure 438230439737 MG_341 MG_342 MG_343
Genes MG_342 View in model
Promoter ‑35 box coordinate (nt) -32
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -15
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -7
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 438730, Length: 507, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGTCAAAAGATCAAAAGTCATTAATTTTAATGCTCTCCAATTCGCAACA
TTCCATTAACAGGAAATTTGCTAATGAATTAAAACATTCTTTAAGTTGTG
AATTGATTGAGTTAAAAGACTATCAAGTTGATTTTTATTCTGTTGATTTA
GAAGCAACTAACTTTCCTGACAAAATTAAAACTTTAGTTAGAAAAATCAA
AGAACATAGCAATTTAATTTTTGTTACCCCTGAACACAACGGTTTTATCC
CTGCTTTTGCTAAAAACATCATTGACTGGATGACTCGTGATGAGCAGTAT
GGTAGAAATCAATTTTTAAAAGGTCTTAATGGAGTTATTTGTTGTGTAAC
TCCAGCAACTGCGGGTGGGGGTAAAACTGTTCTAGAATTACTAGATAAAT
TTTTAAGTTTTAGCGGTCTTAATGTTAAAGGAACAGTTTTAGTCAACGGT
TATCATGAGAACTTTGATTTTAAGCCTTTTATTGAACAAGTTAAAAAATT
AATATAA
50
100
150
200
250
300
350
400
450
500
507
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41