TU_241 – MG_339

Name
WID TU_241 View in model
Name MG_339 View in model
 
Structure (Hayflick media, 37C)
Structure 426590428544 MG_338 MG_339
Genes MG_339 View in model
Promoter ‑35 box coordinate (nt) -121
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -100
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -94
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 427090, Length: 954, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
TTGACAAGTTTTGATTTTTTTGATGCAAAGAAAAACAGTGAAATTGAAAC
AATTTCAACTGGAAGTTTAAATTTAGATGAAGCATTAGGGTCTGGTGGTC
TACCTTTAGGTAGGATAGTAGAACTATATGGAAATGAATCATCTGGAAAA
ACAACTATTGCACTAAATGCAGTCGCTAGTTTTCAGAAAGCAGGTAAAAC
AGCATGTTATATTGATGCTGAAGGTGCACTTGATTTAGCATATGCTAAAT
CAATTGGTATTGATCTAAATAAACTTTTGATTGCTCATCCTAGGCATGGT
GAAAACGCTTTTGCTCTTATCGAATCATTAATTAAAACAAACAAGATATC
TTTAATTGTTATTGACTCTGTAGCAGCGTTAATTCCTAAACAAGAGTTAG
AAGGCACAATTGAAGAACAAACTATTGGCTTGCATGCAAGAATGATGTCA
AAAGGTTTGCGAAGAATACAATCGATATTACCAGATTCTAAAACTTGTGT
TTTATTCATTAATCAGTTACGCGAAAAACCAGGAGTGATGTTTGGAAATA
ACGAAGTTACAACAGGAGGAAAAGCTCTAAGATTTTATAGTTCATTAAGA
ATGGAAGCTAAGCGTGTTGAATTACTTAAGGATAAATTCAACAATTATGT
TGGCATAAAAACAAAAGTAATGGTATCTAAAAATAAGATTGCTAAACCTT
TTGGTGTTGCTATATTAGAAATCATGTTTAACCGTGGTTTTGTACATGAA
CATGAAGTTATTGACTTAGCACTTAAATTTAATGTTGTTGTAAGAGCTGG
AAATTCTTATTCTTTTAACAATGAAAGCATTGCTGTTGGTAAAGAAAAAT
TATTAAATGTTTTATCAGAAAAGCCAGCATTATTTGAACAAATAAAAGAA
CTAACTGTTCAACAATTGGCTAATAAAAATTCATTTCAACAAACAGCTAG
CTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
954
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41