TU_239 – MG_337

Name
WID TU_239 View in model
Name MG_337 View in model
 
Structure (Hayflick media, 37C)
Structure 422197423614 MG_336 MG_337 MG_338
Genes MG_337 View in model
Promoter ‑35 box coordinate (nt) -56
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -31
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -28
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 422697, Length: 417, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
ATGGATATTAGAGCAAGAACAAAAATTATTGATATTTATTCAAATTTAAA
ATACAAAAAACCTCTCAAAAGTTTTCAAAAAATTTTAACAACAAGTGATA
GTGATAATTGTGAAGACTTTTTTAATATAGGTTTAAATATTGATAAAAAT
AAAATTACTGCAATTGGTTTTGATGGTGATGGTTGTATTATCTCTACAAT
TGCAACTGAATTAAGTATTAAAGCAATTGAAAATAAAACTATTAACCAAG
CAAAAAAAATATTATCAGATTTAATTGCAACTTATAAAGATAAAAATTCA
GCAAACCAAGTTGTTGAAGAATTAAAGCTTTTAATTGAAATGAATGTAAC
TGAAAAAAGGTTACAGTGTTTGCTTTTAACACCAAGCAACTTATTGCAAT
GGTTTAAAAATTTTTAG
50
100
150
200
250
300
350
400
417
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:41