TU_236 – MG_516

Name
WID TU_236 View in model
Name MG_516 View in model
 
Structure (Hayflick media, 37C)
Structure 419553420775 MG_335 MG_516 MG_517
Genes MG_516 View in model
Promoter ‑35 box coordinate (nt) -36
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -7
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -3
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 420053, Length: 222, Direction: Reverse, Sequence:
1
51
101
151
201
ATGAATGATCTAGCACTTGCATTAGGTTTAGGTATCCCTCTTTCGCTTTT
GGTGGGAATGATTCTTGGTTATTTTATTTCTATAAAAATCTTTAAAAAAC
AGATGCGTGACAATCCACCTATTACTGAAAATCAAATTAAAGCAATGTAT
GCAAAAATGGGTAGAAAATTATCTGAAACCCAGGTAAAAGAGATAATGCG
CTCCATTAAAAACCAAAAATAA
50
100
150
200
222
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:40