TU_235 – MG_335

Name
WID TU_235 View in model
Name MG_335 View in model
 
Structure (Hayflick media, 37C)
Structure 418970420546 MG_334 MG_335 MG_516 MG_517
Genes MG_335 View in model
Promoter ‑35 box coordinate (nt) -75
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -55
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -49
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 419470, Length: 576, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGGATGCACATTTTTTGAAGAGTGCAAGTGATTTAAAAGATTGTCCTCA
AGATAATATCCCAGAGATTTGTTTCATGGGAAGAAGTAATGTTGGTAAAT
CAAGTTTGATTAATGCTTTTTTTAAAAAGAAACTGGCTAAAACTTCAGCA
ACACCAGGTCGAACACAATTACTAAATTACTTTGAATATAAAGACAAAAG
ATTTGTTGATTTACCAGGTTATGGCTTTGCTAAAATAAACAAAAATAAGA
AAGATTTTATTACTAATTTACTTACCCAATTTTTAAATTTTCGTAGTAAT
CTAGTTGGTGTTGTTTTGATAGTAGATAGTGGAGTTGTTACTGTTCAAGA
TCAGGAAGTGGTTAAAATTATTTTGCAAACAGGATTGAACTTTTTGATTG
TTGCTAATAAATTTGACAAACTAAATCAAAGTGAAAGATATTTTTCGCTT
AAGAATATTGCAAATTTTTTAAAAGTTAATTTTGATAAATGTGTTTTTGC
AAGTACAAAAACACATCATAATCTTGCTTTAGTTCACAAAAAAATTTTCG
AATTATTCGTTGAAGATGAAAGATAA
50
100
150
200
250
300
350
400
450
500
550
576
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:40