TU_227 – MG_0004

Name
WID TU_227 View in model
Name MG_0004 View in model
 
Structure (Hayflick media, 37C)
Structure 406042407430 MG_0003 MG_0004 MG_323 MG_515
Genes MG_0004 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 406542, Length: 388, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
TGGTGGAGATGACGGGAATCGAACCCGTTTCCATAAAGGACACAACAAAC
AGCTTCTACATTTTAGTTTTGTGGATTTTTGTCTTGTTTCCAATTGATCA
CAAAACAATCATGGAAACAACAAGTTCTATTTTTAAAGGTTAAATTGAAC
GATTTAACCTCGAGTCATAAACTATGACAGCTAGCAAACTATGACTATTC
ACCAGCTGTAGCTTTAGTATCTACTTATGCAAAAGCAAAGTTAACACTTG
CTTGTTGGTTAATGATCAAATTTGGATCTACCAACACTTCGTTATTTTCT
TTGTCGGTTATTGAACCTAGCGCTGTAAGGGGCATACCCCAATGCTACTG
TTTGTCTATCAGCATTATGTCAAACCCAAAACATCCCC
50
100
150
200
250
300
350
388
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:40