TU_225 – MG_323

Name
WID TU_225 View in model
Name MG_323 View in model
 
Structure (Hayflick media, 37C)
Structure 404956406640 MG_0003 MG_322 MG_323
Genes MG_323 View in model
Promoter ‑35 box coordinate (nt) -37
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -12
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -5
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 405456, Length: 684, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGAAACGTGCAGATTTTTGCATTATTGGTTTAGGTAGATTTGGGATGCA
GGTTGCACAATCACTAAAAGAAAACAACTTTAACTTACTTTTAATTGATC
TTGATGATAAAAAAACTGACACCGCCTCGCAACAGTTTGATTATGTTATT
TGTTGTGATGCTAGTAATCTAACTGCTTTAGAAGAGTTACAAATTGATGA
ATTTGCTGGGGTTATTGTTGGGGTTACCAACATAGAAGCGAGCATCATGA
TATGTGCTAATTTAAGGGAATTAGGACAAAAAAACATTATTGCTAAAGCC
AAAAATGAAGTACATAAAAGGGTGTTAAGCACAATGGGAATTAGAGAAGC
TTTGATCCCTGAAAAGATTGTTGGTAAAAATCTGGTTATCCGCTTAATCC
ATGGGCTTGAAAATGAAATTATCAACCTTGGTAATGAGATAATTTTCATC
CGTTCAGCAGTTAACAACAAGGCTTTTTTTAACAAAAGGTTAGAAGAGAT
TAACTTTAGGCAAAACACCGATGCTAACATTATCTCCATCATGCGCAGTA
ATAAAACTGTTGTTTTTCCTTTAGGACCAAATACTGAGATCCAACCAGGG
GATATTATCACTGCAGTTTGTCAACAAAAAAGTTTAAATAAGTACTTAAA
TTACATCAATCCTAAAACCAAAAATAAAAATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
684
View in model
 
Metadata
Created 2012-10-01 15:09:20
Last updated 2012-10-01 15:18:40