TU_223 – MG508 - MG514

Name
WID TU_223 View in model
Name MG508 - MG514 View in model
 
Structure (Hayflick media, 37C)
Structure 402634404202 MG508 MG509 MG510 MG511 MG512 MG513 MG514 MG_321 MG_322
Genes MG508, MG509, MG510, MG511, MG512, ... 2 more View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 403134, Length: 568, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
GGCCACATAGCTCAGCGGTAGAGCAACCGGCTGTTAACCGGTTGGTCACA
GGTTCGATCCCTGTTGTGGCCGCCATTATTTGGCGCGTTGGTGAAGAGAC
TTAACACACACGCCTTTCACGCGTGCATTCACGGGTTTGAATCCCGTACG
CGTCACCAATGCCGAATTAGCTCAAGGGCAGAGCGATGCACTCGTAATGC
ATAGGCTACAGGTTCAATTCCTGTATTCGGCACCATAAGTGATGGATTGT
TAGCTCAGCTGGGAGAGCATATGCCTTACAAGCATAGGGTCGGGGGTTCG
ATCCCCTCACAATCCACCATGCCGACTTAGCTCAGTTGGTAGAGCAATTG
ACTTGTAATCAATAGGTCGTAGGTTCAAATCCTATAGTCGGCACCACTAT
CTGCATCTTTAGCTCAGTTGGTAGAGCAAATGACTCTTAATCATTGGGTC
GTGGGTTCGATCCCCTCAAGATGCACCAATAATGCACTCGTGGCGGAATG
GTAGACGCGCTAGACTTAGGATCTAGTTTCATCTAGAAGTGGGGGTTCAA
GTCCCTTCGGGTGCACCA
50
100
150
200
250
300
350
400
450
500
550
568
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:40