TU_221 – MG507

Name
WID TU_221 View in model
Name MG507 View in model
 
Structure (Hayflick media, 37C)
Structure 399460400549 MG506 MG507 MG_320 MG_321
Genes MG507 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 399960, Length: 89, Direction: Forward, Sequence:
1
51
GGAGATTTACCCAAGTGGCTGAAGGGGGCGCTCTCGAAAAGCGTTAGGTG
GTTATCCACGCGTGGGTTCAAATCCCACAATCTCCGCCA
50
89
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:39