TU_220 – MG506

Name
WID TU_220 View in model
Name MG506 View in model
 
Structure (Hayflick media, 37C)
Structure 399368400459 MG506 MG507 MG_320 MG_321
Genes MG506 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 399868, Length: 91, Direction: Forward, Sequence:
1
51
GGATACTTACCCAAGTGGCTGAAGGGGTAGGCTTGGAAAGCTTATAGATG
GGTAAAACCATGCGAGGGTTCGAATCCCTCAGTATCCGCCA
50
91
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:39