TU_218 – MG_319

Name
WID TU_218 View in model
Name MG_319 View in model
 
Structure (Hayflick media, 37C)
Structure 397798399335 MG_318 MG_319 MG_320
Genes MG_319 View in model
Promoter ‑35 box coordinate (nt) -52
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -33
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -30
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 398298, Length: 537, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGCGCTTGTTTCGATTTCTCTTTAAGCTTTGCTTTCTTTTATTGGTATT
GGTAGGCTTTGCTTATCTTTTCTTAGCTATCTTTTACTTTGGTTCTCTAA
ACCCATTTGAGTTAGCACAACCAATGGATGTTTTCAACAGGTTCTTTTCA
AAAGAAGCGTTGGATAACATCTCTTCAAACAATGGTGCAACTGCAACTGC
TCAAACAAGTAGCTTATTACAACTTTTAGAAGGTTCAAGTAATGGTTTGG
ATAACCGTTTTCCAACTGAAAAAAGTGCATTTTATGCTATCCCAGGATAT
GTAGATTTTTTGAAAAATGCTAAGTTGCCTGGATTTGTTGAACAGTTTAC
ACCTTATCTAACTAAGTATGTAATTCCCCTAGGAATGGCATTTGTTAGTG
GTTTAATAGGTACTTTAATTGTTAACTTCTTTCTCAATAAAATCACTCGT
TCAATTAAAAGAAGAAAAAGGAACATGAAAAAGCAAGAACAAGAAGAGTA
TTATGATGATTCAAGATCAAGAAGAAAAAGGAACTAA
50
100
150
200
250
300
350
400
450
500
537
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:39