TU_213 – MG_311

Name
WID TU_213 View in model
Name MG_311 View in model
 
Structure (Hayflick media, 37C)
Structure 386776388394 MG_310 MG_311 MG_312
Genes MG_311 View in model
Promoter ‑35 box coordinate (nt) -28
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -10
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -2
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 387276, Length: 618, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGAAATATACTGGTAGTATTTTCAAACGATCAAGACGTTTAGGTTTTTC
TTTACTTGAAAACAACAAAGAGTTTTCCAAAGGAAAAAAACGTAAATCTA
TTCCCGGTCAACATGGAAATAGGTTTCGTTCCTCAACTTTATCAGGTTAT
GCCCAACAACTCCAAGAAAAACAAAGGATGCAATACATGTATGGTATTAC
TGATAAACAATTTCGTAGGTTATTTCGCTTTGTTTTAAAACAAAAAGGTA
ACTTAACAGTTAATTTATTTAGAGTTTTAGAATCACGTTTGGATAACATA
GTTTACAGAATGGGTTTTGCACCAACAAGAAAGAGTGCAAGACAAATGGT
AAACCACGGTCATGTGATTTTAAATGATCAAACTGTTGACACCCCTTCAA
TCATCATTAATCCCGGGGATAAAGTCCGTTTAAAAGCAAGAATAACTAAA
TCCCCATTAGTTAAAAATTTTATTGAAAACAGTGTTATCTCATCATTTGT
GGAAACCAACAAAAAGGCATTTGAAGGTACTTATATAAGATTCCCAGAGC
GTAGCGAACTACCTGCTGGAATAAATGAATCTTACGTTGTTGAGTGATAC
AAGCGTTTAGTTAAATAA
50
100
150
200
250
300
350
400
450
500
550
600
618
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:38