TU_207 – MG_304

Name
WID TU_207 View in model
Name MG_304 View in model
 
Structure (Hayflick media, 37C)
Structure 373481375294 MG_303 MG_304 MG_305
Genes MG_304 View in model
Promoter ‑35 box coordinate (nt) -30
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -11
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -5
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 373981, Length: 813, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
TTGCTACAAGTTAAAAACCTCAGTTTTAAATACCCAAAACACCAAAACAA
TGTGTTAAATCAGATTAGTTTTAATGTTCAAGATGGGTGTCATTTAGCAG
TAATAGGTCATAACGGTTCAGGTAAATCAACCCTAGTTAAACTCCTTGGC
GGATTTCTAAAAGCTAAAAAAGGAACTATCTTTTTCAATGATAAGGAGTT
GACTTCTGTTGGTTTTAATAAGATTGGAATCTTATTACAAGACCCTGATG
TGCAATTACTTGCTGATACACTCCACCAGGAATTGATTTTTACTTTGGAA
AACCATGGAGTTTTAGCTAGTGAAATGGATAAGATTATTAATGAAGTTTT
AACTGTTGTTGAATTGAAAGATAAACAATTTACACCACTTAAAAAACTTT
CATTTGGTGAAAAACAACGTGCTGTTTTTGCTTGTTTATTGGCTGTCAAA
CCACAAATTTATCTGCTTGATGAGGCATTTAGTATGCTTGATAATAAGAT
CAGCAATAAACTTAAAAAATTTGTGTTTGATACCATCAAAAAACAAAACA
AAATAGTTATCAATATTACCCATGATTTTAATGATCTGTTTCTAGCAGAT
GAGATTATCTTTTTAAGTAAAGGATCGCTAATTAAAAAGTTTGCTCCTGA
AGCGATATATGAGCAGCTTGATTTGTTTCATAACCACCACTTTAATCTCC
CTTTTCCACTTTTATTGGCCCATAAGGTGGCTAAACAAATAAACAAAAAA
ACACCAAGTTTAAGTTTTGAATTGAATGATGTAGTTAACTGGATATGCAA
ACACCTCAAATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
813
View in model
 
Regulation
Regulation View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:38